So many of you have asked similar questions of why “Whatever happened to Sir Professor Gary Foster FRS CBE?!”

On this particular day 🤔

Do I do an Aprils Fool joke this year. Nah. You’re all too gullible.

104,000 people at this concert. And who was in charge of bossing them around. Yep, her…… ❤️

First photos as BTS make live return in front of huge crowd www.bbc.co.uk/news/article...

Well said sir.

Someone called us PIPS the other day ~ PREVIOUSLY IMPORTANT PEOPLE! So true. Career highlights fade away and how we impacted family and friends so much more important.

Signed, a proud PIP

This is a weird life moment for me. About to support England 🏴󠁧󠁢󠁥󠁮󠁧󠁿 in the rugby 🏉

😂😂😂😂😂

Great isn’t it 😀

There’s no better feeling than being an Irish man living in England when Ireland are stuffing England in the rugby 🏉

#heaven #bliss

A tobacco plant showing slight signs of aging after three days of signal-to-noise ratio testing.

Researchers have designed an electrode that allows for a month-long, noninvasive method of studying physiology and health in a diverse array of plants.

Learn more in this week’s issue of #ScienceAdvances: https://scim.ag/4aay3yP

Light pollution creates multiple threats to the movement ecology of nocturnal arthropod taxa Light pollution is a major contributing factor to declines in global biodiversity1,2 that is steadily increasing in both severity and spatial extent.3…

Our researchers reveal that light pollution disrupts nocturnal insects & spiders' movements.🏙️🕷️

Dr Rochelle Meah & Prof Nicholas Roberts highlight two key effects:

1️⃣ Masked day-to-night transitions. 🌙🕷️
2️⃣ Blinded polarized light for navigation.☀️🦋

Read➡️: www.sciencedirect.com/science/arti...

Starting heating it up the day before you need it 🙃 from personal experience. But they’re amazing

From Genomic Context to Sensor Design: Computational Identification of AMR Biomarkers in Agriculture (project at Queen's University Belfast) at University of Reading on FindAPhD.com PhD Project - From Genomic Context to Sensor Design: Computational Identification of AMR Biomarkers in Agriculture (project at Queen's University Belfast) at University of Reading, listed on FindAPhD....

Last chance to apply for our funded PhD opportunity. w. Prof. Fredric Coulon @ Cranfield University. This will investigate expansion of ML models for AMR phenotype detection to agriculture settings to create a sensor-ready hit list.
Detail here:
www.findaphd.com/phds/project...

UKRI pauses several funding calls amid priorities shake-up

The applicant-led MRC funding calls on pause include research grants, partnership grants and new investigator research grants made available through the council’s research boards.

www.researchprofessional.com/news-article...

Characterising antibacterial toxins in the food-borne pathogen Listeria monocytogenes at Newcastle University on FindAPhD.com PhD Project - Characterising antibacterial toxins in the food-borne pathogen Listeria monocytogenes at Newcastle University, listed on FindAPhD.com

www.findaphd.com/phds/project... interested in bacterial antagonism? PhD opportunity in our team, see below. Please repost!

Needed hot sausage roll and hot drink as beach very windy and cold 🥶

Before I retired, colleagues couldn’t believe that I’d just walk away easily. Saying I was so passionate about science and lecturing and my commitment to the university as a whole. You’ll get bored they said.

Err…..no 😂

Best life after 🙃

Available to a good home: A beer belly...I've been looking after it over Xmas as I can't locate it's owner. It's not damaged..... It follows me everywhere and is very cuddly.

New Year Honours: Idris Elba, Torvill and Dean, and Lionesses among those recognised A huge number of people earned gongs this year - here are some of the stand-out names of the 1,157 people recognised.

I turned my mine down again. The just won’t leave me be.

news.sky.com/story/new-ye...

Something for the nerds out there....
CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGGACGTGGGAAGAACCCTCG

💩????????

Been a while since I published children’s books. But now that our wee man is 22 months & LOVES books, how could Granny & Gramps not write a new one.

Now available in all good book shops and all online sites

Dylan and the Dinosaur 🦖

amzn.eu/d/2vyxxt2

Publish or Perish: A Humorous Party Game about Academic Publish Welcome to the chaotic life of academic publishing. In this game, you are a clueless researcher trying to do the one and only thing that matters in your academic life: churning out publications, fast....

Publish or Perish: A Humorous Party Game about Academic Publishing

The Publish or Perish Game is a humorous party game about academic publishing. Players race to publish manuscripts with useless nonsense while sabotaging each other's research!!!!!

publishorperish.games?utm_medium=p...

One man (little old me) and his dog.

Building capacity in vector‐borne plant virus research: The CONNECTED Network Plant viruses spread by insects decimate crop yields globally, causing food security challenges in vulnerable areas, including regions of Africa. Interdisciplinary research is needed to protect futur...

Building capacity in vector-borne plant virus research: The CONNECTED Network

nph.onlinelibrary.wiley.com/doi/10.1002/...

Oh how us virologists ranted and raved. But no one listened.

‘Too little, too late’: damning report condemns UK’s Covid response

‘Too little, too late’: damning report condemns UK’s Covid response Report on handling of pandemic contains stinging criticism of ‘toxic and chaotic’ culture inside Boris Johnson’s No 10

www.theguardian.com/uk-news/2025...