AI can code, but it can't architect your app. Human judgment keeps code maintainable. I turned 8,500 lines of AI-coded chaos into a plugin system—here’s what I learned. Ever cleaned up AI code? Repost or share your story! buff.ly/R1AIDyY #softwarearchitecture #aicoding
How do you keep mentoring and leading when budgets are tight? You don’t need big budgets—your skills and network are enough. Here are 5 budget-free ways I’ve helped others grow at work. What’s your go-to strategy? Comment or share! buff.ly/lAKet1K #.mentorship #.careergrowth
What’s the hidden bottleneck in your workflow? Air gaps—manual steps we ignore—add up fast. I share how spotting and closing these gaps saved me time and energy. Have you found air gaps in your work? Comment or repost if this rings true! buff.ly/lhmOcqL #automation #workflow
Are agent skills just for bots, or do they shape how we work too? Workflow skills reveal our habits, not just automate tasks. My daily sign-off skill bakes in my workflow—context matters! What do your automations say about you? buff.ly/flUlA9W #.agentskills #.workflow
PyMC in your browser? It works—just not with NUTS! WASM lets PyMC run client-side, but NUTS is still missing. Spent my weekend getting PyTensor running in WASM. Learned a lot, but NUTS is still out for now. Would you use PyMC in-browser? Repost or comment!
Yeah, 1000%. It helps that I tend to have consistent vocabulary, and I find that putting parentheses around synonyms in strategic places (Maps of Content, for e.g.), helps with searching by meaning. It'll grep by keyword, find nothing, try synonyms, and find the stuff it needs.
No indexing! Just tools: grep, read, etc.
Drowning in work chaos? Plain text + AI agents keep me organized—no vendor lock-in. My Obsidian + Python workflow isn’t perfect, but it’s saved me hours and stress. How do you manage info overload? Comment or repost! buff.ly/BvEYHq8 #.pkm #.aiworkflow
Are coding agents making you better, or just faster? Speed means nothing if you lose control of your analysis. I found that slowing down and adding structure led to 5-10x speedups—without chaos. Does this match your experience? Repost or comment! buff.ly/mbVjECO #datascience #ai
Agentic coding is transforming data science. AI is a collaborator, not just a tool. I distilled 10 lessons from real ML projects—like agent journals and prescriptive prompts. These tips saved me days and sparked new ideas. Which tip would you try? bit.ly/409K82l #datascience #aiagents
📣 @ericmjl.bsky.social is teaching an "Agentic Data Science" workshop to raise funds for #SciPy2026
🗓️ March 27 & April 3, 2-4 PM EST
🎟️ $1,000 minimum donation ($200 for students)
👉️ Sign up at agent-assisted-data-science.vercel.app
👉️ Pay to NumFOCUS (tax-deductible) at givebutter.com/RBJuGI.
Model 'feel' can make or break your coding flow. Harness and feedback loops often matter more than model scores. Switching models and adding fast tests changed my workflow for the better. Agree? Repost or share your experience! buff.ly/Nv2cC1k #ai #devlife
Sign up here! buff.ly/P1T2mh3
5/5
Video recordings available if you can't attend live.
If you've been curious about agentic data science but didn't know where to start, this gives you techniques you can use the next day.
And you'll be supporting the SciPy community at the same time.
4/n
The workshop covers:
- Prescriptive prompting for experiments
- Project structure for agents
- Logging and verification strategies
- Report writing with AI
- Staying in control during EDA
- The minimalist version first
3/n
I've been using these techniques in my projects and with my teammates for the past year to compress experimental timelines from days to minutes. 2/n
Teaching an "Agentic Data Science" workshop to raise funds for SciPy 2026.
Compress weeks of work into a day using coding agents.
March 27 & April 3, 2-4 PM EST
Google Meet
40 spots, $1,000 min donation paid directly to NumFOCUS (tax-deductible)
Sign up: buff.ly/P1T2mh3 1/n
Treat your coding agent like a teammate, not a chatbot. I think the trick is knowing when to update AGENTS.md vs create a skill. I share my simple model for evolving agent workflows and building real leverage. What’s your approach? Comment or share! buff.ly/FluyXjj #.aiagents #.devworkflow
Tired of repeating the same coding steps? Skills—markdown playbooks—make agents smarter and your life easier. I share how skills saved me time and made team know-how reusable. Would you try skills? Comment or repost! buff.ly/rTPYdMf #.ai #.automation
Tired of repeating yourself to coding agents? Agents should actually learn from our feedback. AGENTS .md and simple playbooks helped my agents improve week by week—less babysitting, more progress. Tried this? Let me know or repost! buff.ly/5qi4pic #.ai #.automation
ICE murdered Renée Good in broad daylight. Less than 3 weeks later, they killed Alex Pretti, shooting him 10 times. Every day, we watch as people are ripped from their cars, their homes, their lives.
We can't allow ourselves to look away from this cruelty. Abolish ICE.
Bioinformatics fixed my browser bug. DNA sequence alignment beat string normalization for messy text highlighting. Smith-Waterman, a DNA algorithm, solved my canvas-chat issue. Cross-domain ideas really work! Ever tried a wild fix? Comment or share! buff.ly/wnq3Ewz #.webdev #.algorithms
First contact with GLM-4.7 and... yeah, it feels a lot like Opus 4.5. One-shotting coding problems. I gotta probe where its limits are.
Same goes for product-minded engineers!
Ever wish LLM chats could branch like your thoughts? Linear chat holds us back—so I built Canvas Chat for nonlinear exploration. Open-source, infinite canvas for branching and merging ideas with Claude, GPT, and more. Repost or comment if this sparks ideas! buff.ly/KaFK4fR #.ai #.opensource
AI themed my tmux bar—no plugins needed. AI let me focus on design, not syntax. Claude + OpenCode turned ideas into a terminal I love. You just need vision! How has AI changed your workflow? Repost or comment! buff.ly/aCXmjK1 #tmux #aipairprogramming
I use OpenCode, and have OpenCode read its own session as a way of remembering the exact history of what we did. I then feed AI the narrative I want to tell, and have it fill in the details :)
I don't code anymore—I build. AI lets me ship projects by describing what I want, not how to do it. In 10 days, I shipped 6 projects with OpenCode + Claude Opus 4.5. The gap between idea and product is tiny now. Would you try this? Repost or comment! buff.ly/blroW24 #ai #buildfast
atggaacgccgctattgccatcgcattagcaccatggcgagcgcgaacgatcatgcgccgccgtataacgaatggtatgaagcgcgc!
(if you know, you know what to do!)
🎄Merry Christmas to all! 104 blog posts. 2 years. Here’s what changed for me. Writing weekly turned AI into a true collaborator. Lessons on coding agents, Bayesian stats, and biotech leadership—shared honestly. What did 2025 teach you? Comment or repost! buff.ly/Kkebg57 #blogging #datascience
