🙂 will do. Thanks!

Still looking

Ok, thanks!

#zebrafish Does anyone stateside have a ubi:mRFP-CAAX line? Thanks!

“We report a novel imaging technique using a recently developed clearing reagent called LUCID that makes it possible to capture the complete cellular-resolution 3D structures of larval and juvenile zebrafish.”

New work from Weinstein Lab at NIH 🐟

thanks - will add that info to the site!

shield stage

KI is at the 3' end of the coding sequence - should report on all transcripts.

runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...

#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre...

Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!

So long, NIH. The place I grew up in and discovered my passion for science communication.

I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences.

I'm so devastated that my whole team got laid off today.

Zebrafish Community Cre/lox Resource - Zebrafish Community Cre/lox Resource Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...

#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org

Check out what's available, imaging and information, and make a request.

We're so very grateful to the NIH ORIP for supporting this work!

Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!

Zebrafish Community Cre/lox Resource website (ZebrafishCCR) will be online soon!

Our DyDy zebrafish hand2-cre and hand2-creERT2 KI paper is online!
anatomypubs.onlinelibrary.wiley.com/share/IPCM9K...

Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas.

Ready to ship - email requests to mmcgrail@iastate.edu