Twist CHO cell line & Express Antibody Production information here: www.twistbioscience.com/antibody-dis...

Sunday is World Hamster Day! 🐹

Derived from the ovaries of a Chinese hamster in 1957, CHO cells are used to produce >50% of recombinant therapeutic proteins, including cancer-fighting antibody therapies & meds for rheumatic diseases.

@twistbioscience.com

Today was our fundraiser🎉

Thank you to our panel guests
and to @nucleate.bsky.social and @twistbioscience.com for making this amazing event possible.😊

#SynBio#iGEM#innovation

Exploring a lab-in-the-loop system for antibody design!

Discover how the latest approach to linear DNA expression workflows can streamline antibody design processes: www.the-scientist.com/exploring-a-...

@twistbioscience.com

Artemis II mission is about to fly humans to the Moon — here’s the science they’ll do Set to lift off this week, the NASA flight will take astronauts around the Moon for the first time in more than 50 years.

Have you heard about the science they are doing during the mission?

Hoa Giang, Senior Director of Antibody Services at Twist Bioscience, recently presented preliminary findings from our collaboration with the University of Oxford at SynBioBeta’s Digital Summit.

Watch Now: www.twistbioscience.com/resources/we...

@twistbioscience.com

Our HR team recently stepped out from behind the scenes & into the heart of our operations with a tour of our Wilsonville manufacturing site.

From seeing our writers in action to meeting with the teams on site, it was a great day.

@twistbioscience.com

Simplify your AgBio workflow…

Our Twist FlexPrep™ UHT Pure Ag DNA LP kit offers an end to end validated workflow combining FlexPrep with our DNA purification: www.twistbioscience.com/products/ngs...

@twistbioscience.com

That’s a wrap on #ABRF2026! 🎉
Thanks to everyone who visited our booth, sang karaoke 🎤, and joined our Tech Talk on NGS library prep. From enzyme innovation to your research, we loved every conversation.

Let’s keep it going, reach out anytime!
@twistbioscience.com

AATGAGGTCGAGAGAGGTCAGAATAATGCGGGTATTGTCGAGTACCAGGTAGTACCCTGAAATGAGGTCGAGAGAGGTCAGAATAATGCGCTGGAGACTTACCAGGTAGATCAGTGGAATTGAAATGAGGTCGAGAGAGGTCAGAATAATGCGAGGGTCAATGCGAGACAGGTAAATGATGCGAATGATGATGAGTCCGAGAGAACTTACCAGGTA

@twistbioscience.com

Base Pair Bulletin Twist Bioscience, Mar 2026: new codon optimization tool, Bits to Binders & Bio x AI Hackathon highlights, new publications, synthetic DNA, NGS, biopharma , etc.

March highlights here!👇

Read about everything from our new codon optimization tool to recent competitions (Bits to Binders & Bio x AI Hackathon), new publications, & learn how Emily Leproust is driving the SF Bay area forward!

“High-throughput genotyping of plant and animal tissues with FlexPrep™”
 
Showcases high-quality genotyping data generated from an ultra-high throughput workflow using a novel purification method:

“Development of an optimized hybrid capture system for target enrichment of bovine samples”
 
Demonstrates a scalable genotyping workflow powered by FlexPrep, the Twist Genotyping Panel - Bovine 100k, and Bovine Blockers:

new data showing how high-throughput NGS workflows can simplify genotyping across crops and livestock.

Check out the two posters…

Access unparalleled sequence space for your complex screening projects.

Our Gene Pools are a revolution in pooled DNA synthesis. Access thousands of bespoke Gene sequences up to 1.8kb, pooled together, with 0% chimera rates and <1% dropout*: www.twistbioscience.com/products/gen...

Try it now! codon-optimization.twistdna.com

Why you should try Twist’s new AI-driven codon optimization
✅Driven by a large language model trained on millions of DNA-protein pairs
✅Balances hidden variables across the sequence, not just codon usage
✅Can optimize hundreds of sequences in a matter of seconds

Common limitations of “Rules-Based” codon optimization
❌Optimization of codons is not performed in a sequence-wide context
❌Optimization omits “hidden” information, e.g. mRNA stability
❌Optimization can take a long time for projects with multiple sequences

Are you generating proteins in your research, and are looking to maximize expression?

If so, then @twistbioscience.com’s AI-driven codon optimization tool will be your new favorite addition to your workflow…

Very early morning + late night = 100% worth it at the Berlin Bio x AI Hackathon

We loved hearing from you, & sharing how we support the biological continuum from discovery through application, from DNA synthesis & protein expression to NGS & biologics

Congrats to the teams! 🏆

The Biotech Founders Driving the San Francisco Bay Area Forward in 2026 The San Francisco Bay Area has long been the epicenter of modern biotechnology, but the current moment feels fundamentally different.

🎉 Congratulations to our CEO and co-founder Emily Leproust for being one “of the most notable biotech leaders in the Bay Area, operating at the intersection of scientific ambition & real-world traction.”

Read the article in the San Francisco Tribune👇

⚠️ ONE WEEK to apply for our yeast display course ⚠️

Join us in June to get experience designing yeast display libraries, running #MACS/#FACS sorts & discovering top antibody candidates. Apply now: buff.ly/7rqgQWz

Thanks to our sponsors Alloy Therapeutics, @twistbioscience.com & Sony Biotechnology!

To all those who attended our Copenhagen edition of the @twistbioscience.com Antibody Discovery meet up, thank you!

It was a pleasure to host such an engaged group and discuss the latest in biotech with you.

Precise prep for your target enrichment workflow!

Generate high quality whole genome libraries without amplification, preserving native genome representation.

Find our PCR-Free WGS Library Preparation Kit here: www.twistbioscience.com/next-generat...

@twistbioscience.com

The Presidio & Golden Gate are really showing off from a crisp blue sky & glowy evenings to those little purple flowers.

We love that this is the backdrop for the work we do making DNA for you!

We chatted with Alexandra “Sasha” Nikolaeva & Lydia Smith, studying the coast redwood tree at UC Berkeley.

They chose a custom NGS panel & target enrichment reagents to explore the connection between the redwood genome, niche survival, & climate change: www.twistbioscience.com/resources/ca...

Did you know? We have an on-demand webinar library
Expert-led sessions include:
🤖 AI in Science
🧬 Cancer research
🧪 Functional Genomics
🧫 Protein Engineering
👩‍🔬 Antibody discovery
✂️ CRISPR & Gene Editing
🌱 AgBio
🦠 Infectious Disease…
👉 www.twistbioscience.com/resources/we...

@twistbioscience.com

Using Gene Fragments and Pooled DNA, A-Alpha Bio generates massive, high-quality wet-lab datasets to train its AlphaBind AI model.

This enables the rapid and simultaneous optimization of complex therapeutic antibody properties in a single step: www.twistbioscience.com/resources/ca...

Happy Pi Day (tomorrow) from all of us at Twist! 🥧

3.14159…
We appreciate a constant that reminds us that discovery starts with the right numbers. Like: Twist express genes as fast as 4 days from .3-5kb, or Twist Multiplexed Gene Fragments at 500bp, or NGS panels to >1 million probes/pool

Microarrays built the foundation of high-throughput genotyping. Now NGS is redefining it.
Join @twistbioscience.com, Ultimate Genomics & Gene by Gene to hear how a highly automated genomics lab transitioned 100% of its sample volume from arrays to NGS in just 4 months: event.on24.com/wcc/r/526271...