DECIPHER version 11.38 has been released. See the new features at www.deciphergenomics.org #variantinterpretation

From delivering genomics training across 16 countries to making bioinformatics more accessible worldwide, Aleena connects science, people, and cultures.
www.embl.org/news/people-...
#Bioinformatics #Genomics @ensembl.org

Want to level up your fungal genomics skills? Join our hands-on virtual training in Fungal Pathogen Genomics, covering Ensembl Fungi and other top web-resources for the field. Apply today!

coursesandconferences.wellco...

Applications close: 28 March 2026
Course runs: 1-5 June 2026

A screenshot of a Nature Methods article on the human pangenome.

Our #Ensembl colleague, Leanne Haggerty, along with scientists around the globe, recently spoke to Nature Methods (@natureportfolio.nature.com) about the human pangenome and its importance in research. You can read the full article at www.nature.com/articles/s415...

What a great campaign and lovely seeing @vickyhatch.bsky.social being featured!

Dr. Jorge Batista Da Rocha ( @ensembl.org ) will demonstrate how researchers can access, explore, and analyze genomic data using the Ensembl genome browser, while Dr. Jen Kong (VectorBuilder) will show how those genomic insights can translate directly into practical vector design using VectorBee.

Excited to build cutting-edge web tools for genomic research? Join us at @ensembl.org as a Web Developer. Apply here: www.ensembl.info/2026/03/04/...

Closing date: 25th March 2026

This #RareDiseaseDay we’re highlighting how data sharing supports diagnosis, research & families living with rare conditions.
Watch to find out how access to rare disease data can help families better understand their children’s conditions.
@uniquecharity.bsky.social @geneticallianceuk.bsky.social

Exciting opportunity to join our team!

Job: Genomics Technology Infrastructure Team Leader
Please follow the instructions in the ad to apply (www.ensembl.info/2026/02/17/...).
Closing date: 25/03/2026

Ensembl release 116 & Ensembl Genomes release 63 are coming in April 2026!
Read more in our declaration of intentions blog:
www.ensembl.info/2026/02/12/...

From summer 2026, ensembl.org redirects to beta.ensembl.org. Previous versions remain in Ensembl Archives.

If you haven't shared your views on future genomics training & events yet, do it soon for a chance to win. 👀

Once completed, you'll be entered into a prize draw for a chance to win 1 of 3 registration passes (incl. accommodation) to a Connecting Science conference of your choice. 🎉
Link below ⤵️

Photographs of the Festival of Genomics banner and Genome Dome session agenda.

We are at the Festival of Genomics in London! Join #Ensembl at the “Genome Dome” at 16:00 today to learn about latest new genomes and annotations available via beta.ensembl.org

#FOG2026

Get to know the people behind Ensembl and meet Disha Lodha from the Ensembl Plants & Metazoa team in our latest #Teamsembl blog post at www.ensembl.info/2026/01/27/...

Exciting opportunity at Ensembl!
We’re hiring a Bioinformatics developer to contribute to the development of the Ensembl Variant Effect Predictor (VEP).
More info: www.ensembl.info/2026/01/22/...
#Jobs #bioinformatics

Recruitment for the EMBL International PhD Programme is officially open! 🔊

At EMBL, we train young scientists to become skilled and creative future leaders in academia, industry and other sectors. Start your career in the life sciences with us!

🔎 Read more here:
tinyurl.com/4jdt2ra5

Exciting opportunity at Ensembl!
We’re hiring a Bioinformatician to help drive large-scale genomics and generate gene annotation for GENCODE or PARADIGM.
More info: www.ensembl.info/2026/01/05/...

Service notice - we are working on server issues affecting the Ensembl mirror sites. Workaround - ensembl.org?redirect=no or an archive may2025.archive.ensembl.org/. You can try the new Ensembl site at beta.ensembl.org and let us know about the features you would like to see!

How can animal genomics communities coordinate data resources? Garth Ilsley presents with highlights from the FAANG and Ensembl Regulation data portals #PAG33

Uniprot @uniprot is developing new strategies and workflows for reference proteomes of agricultural species - Pedro Raposo presents at #PAG33

Elspeth Bruford presents on gene naming by the HUGO gene nomenclature committee, over 44000 genes named to date! “Nomenclature should not be offensive or pejorative”! @hgnc.bsky.social #PAG33

New long transcriptomic data are introducing complexities and opportunities into manual genome annotation! Jane Loveland @janeloveland.bsky.social shares new insights @gencodegenes.bsky.social #PAG33

José Pérez-Silva @jgperezsilva.bsky.social presents on gene annotation methods used by Ensembl at #PAG33

If you're in sunny San Diego for #PAG33, join us at our workshop, “Integrated Genome Resources at EMBL-EBI”, to learn more about our exciting new features and data resources for genomics and pangenomics!


It's on Sunday 11 January from 8:00– 12:00, we hope to see you there!

Photographs of the nine-banded armadillo and common buzzard.

New #GeneAnnotation has been added to #Ensembl Beta, including annotation for Dasypus novemcinctus and Buteo buteo!
You can explore all available species here: beta.ensembl.org/species-sel...

Image credits:
commons.wikimedia.org/wiki/F...
commons.wikimedia.org/wiki/F...

Hello, happy New Year!

Three roles are currently open at Ensembl:

Genomic Data Analyst
Closing date: 10 Jan 2026

Genomic Data Analyst Project Lead
Closing date: 10 Jan 2026

Senior Platform Developer
Closing date: 24 Jan 2026

More info on current vacancies here (www.ensembl.info/category/06-...)

Genomic Data Analyst About the Team The HAVANA team, part of Ensembl, produces reference-quality gene annotation for the human and mouse genomes as a core contributor to the GENCODE project, a Global Core Biodata Resource...

The HAVANA team at EMBL-EBI has multiple open positions to support the GENCODE and PARADIGM projects. We're recruiting gene annotators (bit.ly/4qG28g5), an annotation project lead (bit.ly/4qv05v6), and bioinformaticians (bit.ly/4qevYIY). Please apply via the links. We’d love to hear from you!

Riddle number two of the day: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.

Ensembl Job alert! Bioinformatics Developer in Ensembl Compara
Apply here: www.ensembl.info/2025/12/10/...
Closing date: 12 January 2026

Graphic with a 10 surrounded by fireworks and the Open Targets Platform logo

#OnThisDay 10 years ago, we launched the Open Targets Platform! 🎂 🧬🖥️